| WormBase ID | WBStrain00054654 | CGC Received | 2022-09-07 |
| Genotype | pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. | Laboratory | CGC |
| Made By | WBPerson22706 | Name | AX7884 |
| Outcrossed | x0 | Remark | Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC)encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases.Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004076 | pod-2 | W09B6.1 | Caenorhabditis elegans |
| WBGene00004258 | pyc-1 | D2023.2 | Caenorhabditis elegans |
| WBGene00009319 | mccc-1 | F32B6.2 | Caenorhabditis elegans |
| WBGene00017864 | pcca-1 | F27D9.5 | Caenorhabditis elegans |
