1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000296 | cat-2 | B0432.5 | Caenorhabditis elegans |
| WormBase ID | WBStrain00054678 | CGC Received | 2022-07-29 |
| Genotype | cat-2(cer181[cat-2p::gfp::H2B 1-3]) II. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | CER588 |
| Outcrossed | x0 | Remark | Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martnez-Fernndez C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130 |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000296 | cat-2 | B0432.5 | Caenorhabditis elegans |
