2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00012802 | set-25 | Y43F4B.3 | Caenorhabditis elegans |
| WBGene00019883 | met-2 | R05D3.11 | Caenorhabditis elegans |
| WormBase ID | WBStrain00054548 | CGC Received | 2023-06-02 |
| Genotype | met-2(ok2307) set-25(n5021) III. | Laboratory | ZT |
| Made By | WBPerson1503 | Name | ZT62 |
| Outcrossed | x0 | Remark | Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00012802 | set-25 | Y43F4B.3 | Caenorhabditis elegans |
| WBGene00019883 | met-2 | R05D3.11 | Caenorhabditis elegans |
