3 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00017990 | cec-4 | F32E10.2 | Caenorhabditis elegans |
| WBGene00017993 | cec-5 | F32E10.6 | Caenorhabditis elegans |
| WBGene00021913 | cec-8 | Y55B1BR.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00054542 | CGC Received | 2023-06-02 |
| Genotype | cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. | Laboratory | ZT |
| Made By | WBPerson1503 | Mutagen | CRISPR_Cas9 |
| Name | ZT34 | Outcrossed | x1 |
| Remark | Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00017990 | cec-4 | F32E10.2 | Caenorhabditis elegans |
| WBGene00017993 | cec-5 | F32E10.6 | Caenorhabditis elegans |
| WBGene00021913 | cec-8 | Y55B1BR.3 | Caenorhabditis elegans |
