WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00054548 CGC Received  2023-06-02
Genotype  met-2(ok2307) set-25(n5021) III. Laboratory  ZT
Made By  WBPerson1503 Name  ZT62
Outcrossed  x0 Remark  Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.
Species  Caenorhabditis elegans

2 Alleles

Public Name
n5021
ok2307

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00012802 set-25 Y43F4B.3 Caenorhabditis elegans
WBGene00019883 met-2 R05D3.11 Caenorhabditis elegans