WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00054543 CGC Received  2023-06-02
Genotype  cec-8(fj63) III; cec-4(ok3124) cec-5(fj61) him-8(e1489) IV. Laboratory  ZT
Made By  WBPerson1503 Mutagen  CRISPR_Cas9
Name  ZT35 Outcrossed  x1
Remark  Maintain at 20C or lower. Him. The cec-8; cec-4 cec-5 him-8 quadruple mutant exhibits partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. Species  Caenorhabditis elegans

4 Alleles

Public Name
e1489
ok3124
fj61
fj63

1 Data Sets

Name URL
WormBaseAcedbConverter  

4 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001867 him-8 T07G12.12 Caenorhabditis elegans
WBGene00017990 cec-4 F32E10.2 Caenorhabditis elegans
WBGene00017993 cec-5 F32E10.6 Caenorhabditis elegans
WBGene00021913 cec-8 Y55B1BR.3 Caenorhabditis elegans