WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00054549 CGC Received  2023-06-02
Genotype  csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Laboratory  ZT
Made By  WBPerson1503 Mutagen  CRISPR_Cas9
Name  ZT64 Outcrossed  x1
Remark  fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. Species  Caenorhabditis elegans

1 Alleles

Public Name
fj150

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017641 csr-1 F20D12.1 Caenorhabditis elegans