WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00054751 CGC Received  2023-01-10
Genotype  ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  GLW89
Outcrossed  x0 Remark  N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd 5 AGGGCGAGAGATTATCGGGA 3; rev 5 CGGATCGTTGAGAATGTGTCC 3. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3 (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00008852 ubql-1 F15C11.2 Caenorhabditis elegans