WormMine: Gene WBGene00073525

• WormBase Gene ID: WBGene00073525
• Gene Name: CRE19572
• Sequence Name: CRE19572
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Transketolase family; Transketolase, N-terminal; Transketolase, thiamine diphosphate binding domain; and Thiamin diphosphate-binding fold.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE19572.1	CRE19572.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE19572	CRE19572		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115380
• Remark: CRE19572, TTCGCGCAATCAACGGTTCCGAGAGGCTGGGCATTGGCAAACGAACTGCAGTGGGATGAA, WBGene00073525
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term