| WormBase ID | WBStrain00055439 | CGC Received | 2022-06-20 |
| Genotype | rnp-6(ve790[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC20 [dpy-5(tm9709)] I. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | RG3290 |
| Outcrossed | x6 | Remark | Early larval arrest. Deletion of 7256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain KR16. unc-11 dpy-5 homozygotes no longer carrying the duplication were outcrossed 5 times to N2 to remove dpy-5; however, unc-11 may still be in the background. rnp-6 deletion was balanced over tmC20 [dpy-5(tm9709)] by crossing with strain FX30235. Balanced heterozygotes are semi-Dpy GFP+, and segregate semi-Dpy GFP+, early larval lethal GFP+ (ve790 homozygotes), and non-GFP dpy-5 animals (tmC20 homozygotes). Maintain by picking semi-dpy GFP+. Left flanking Sequence: attaaaaacatggaggaattcgagaataca ; Right flanking sequence: GCCTGTTTTCGATGTCTGCCGAGTTTTCTT. sgRNA #4: TGGAAATACTGTCAAAGCGG; sgRNA #2: AGACATCGAAAACAGGCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001067 | dpy-5 | F27C1.8 | Caenorhabditis elegans |
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004389 | rnp-6 | Y47G6A.20 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
