WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055524 CGC Received  2022-04-18
Genotype  kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  RG5043
Remark  umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. Species  Caenorhabditis elegans

1 Alleles

Public Name
e128

1 Data Sets

Name URL
WormBaseAcedbConverter  

5 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001072 dpy-10 T14B4.7 Caenorhabditis elegans
WBGene00002238 kars-1 T02G5.9 Caenorhabditis elegans
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans