1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00007297 | vsra-1 | C04F12.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055736 | CGC Received | 2023-06-02 |
| Genotype | vsra-1(tm1637) I; fjSi3 II. | Laboratory | CGC |
| Made By | WBPerson1503 | Mutagen | MosSCI |
| Name | ZT24 | Outcrossed | x1 |
| Remark | fjSi3 [HA_2FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00007297 | vsra-1 | C04F12.1 | Caenorhabditis elegans |
