1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00017641 | csr-1 | F20D12.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055735 | CGC Received | 2023-06-02 |
| Genotype | fjSi1 II; csr-1(fj54) IV. | Laboratory | CGC |
| Made By | WBPerson1503 | Mutagen | MosSCI |
| Name | ZT22 | Outcrossed | x1 |
| Remark | fjSi1 [2FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00017641 | csr-1 | F20D12.1 | Caenorhabditis elegans |
