1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001214 | ego-1 | F26A3.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055737 | CGC Received | 2023-09-08 |
| Genotype | ego-1(fj114[PA::ego-1]) I. | Laboratory | CGC |
| Made By | WBPerson1503 | Mutagen | CRISPR_Cas9 |
| Name | ZT49 | Outcrossed | x1 |
| Remark | Four amino-acid residues (G24V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001214 | ego-1 | F26A3.3 | Caenorhabditis elegans |
