3 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000592 | coh-3 | F08H9.1 | Caenorhabditis elegans |
| WBGene00006794 | unc-60 | C38C3.5 | Caenorhabditis elegans |
| WBGene00021560 | coh-4 | Y45G5AM.8 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055740 | CGC Received | 2023-09-08 |
| Genotype | coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. | Laboratory | CGC |
| Made By | WBPerson1503 | Mutagen | UV+TMP |
| Name | ZT73 | Outcrossed | x1 |
| Remark | Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000592 | coh-3 | F08H9.1 | Caenorhabditis elegans |
| WBGene00006794 | unc-60 | C38C3.5 | Caenorhabditis elegans |
| WBGene00021560 | coh-4 | Y45G5AM.8 | Caenorhabditis elegans |
