WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055432 CGC Received  2022-02-23
Genotype  +/mT1 [umnIs52] II; pod-1(ve783[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  RG3283
Outcrossed  x0 Remark  umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 9240 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve783 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gagacaaataaaaagcgagagagggagagg ; Right flanking sequence: tggcccgaaatttatatcaattttgcggac. sgRNA #1: tggtgatggattggtgatgg; sgRNA #2: agcgcacacacaaacacaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Species  Caenorhabditis elegans

1 Alleles

Public Name
e128

1 Data Sets

Name URL
WormBaseAcedbConverter  

5 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001072 dpy-10 T14B4.7 Caenorhabditis elegans
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004075 pod-1 Y76A2B.1 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans