WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055425 CGC Received  2022-03-30
Genotype  dna-2(ve776[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  RG3276
Outcrossed  x0 Remark  umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Maternal effect sterile. Deletion of 3982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that produce sterile progeny (ve776 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatgtctgctgcccgcccgcccgttgcct ; Right flanking sequence: ccttttttactcatttattagatttctcac. sgRNA #1: gattctggctgcgaaatacg; sgRNA #2: cgggaattTTACAGTTGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
Species  Caenorhabditis elegans

2 Alleles

Public Name
e128
e444

1 Data Sets

Name URL
WormBaseAcedbConverter  

6 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001016 dna-2 F43G6.1 Caenorhabditis elegans
WBGene00001072 dpy-10 T14B4.7 Caenorhabditis elegans
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006787 unc-52 ZC101.2 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans