1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000683 | col-109 | Y38C1BA.3 | Caenorhabditis elegans |
WormBase ID | WBStrain00055301 | CGC Received | 2022-06-15 |
Genotype | col-109(sy1744) IV. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | PS9364 |
Outcrossed | x0 | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-109. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gatcaccttttcccccattcgttttttccagTC right flanking sequence: GACCGCCAGAGATATCATGTCTGAAATCAGTCACAAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATATCTCTGGCGGTCGAC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000683 | col-109 | Y38C1BA.3 | Caenorhabditis elegans |