2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001864 | him-5 | D1086.4 | Caenorhabditis elegans |
| WBGene00019160 | nlp-49 | H05L03.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055334 | CGC Received | 2023-08-02 |
| Genotype | him-5(e1490) V; nlp-49(sy1815) X. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | PS9529 |
| Outcrossed | x0 | Remark | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-49 into parental strain CB4088. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGCTTTTGGCTGTTTTCTGCATTGCTGCCTAT. Right flanking sequence: CCTGGGCTGATGGGgtatgttccaatattgaacc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTGCATTGCTGCCTATGCCT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001864 | him-5 | D1086.4 | Caenorhabditis elegans |
| WBGene00019160 | nlp-49 | H05L03.3 | Caenorhabditis elegans |
