1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00007333 | ufd-3 | C05C10.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055327 | CGC Received | 2023-08-02 |
| Genotype | ufd-3(sy1798) II. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | PS9500 |
| Outcrossed | x0 | Remark | Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ufd-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into very 1st exon of the gene. Left flanking sequence: CAATTTCCCATGTTATTGAAGCCCACAAATCCGACA. Right flanking sequence: CAAAGGCTTTGGCAGTTACTCAAGGCGGATGCTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AGCCCACAAATCCGACACAA Method Reference: Wang H, et al. G3 (Bethesda).2018 Nov 6;8(11):3607-3616. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00007333 | ufd-3 | C05C10.6 | Caenorhabditis elegans |
