2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001864 | him-5 | D1086.4 | Caenorhabditis elegans |
WBGene00007664 | seb-3 | C18B12.2 | Caenorhabditis elegans |
WormBase ID | WBStrain00055325 | CGC Received | 2022-06-15 |
Genotype | him-5(e1490) V; seb-3(sy1794) X. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | PS9496 |
Outcrossed | x0 | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00001864 | him-5 | D1086.4 | Caenorhabditis elegans |
WBGene00007664 | seb-3 | C18B12.2 | Caenorhabditis elegans |