2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000898 | daf-2 | Y55D5A.5 | Caenorhabditis elegans |
WBGene00011083 | glo-1 | R07B1.12 | Caenorhabditis elegans |
Oops!
http://intermine.wormbase.org/tools/wormmine/service/ is incorrectWormBase ID | WBStrain00055239 | CGC Received | 2022-06-15 |
Genotype | daf-2 (e1370) III; glo-1(sy1306) X. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | PS8441 |
Outcrossed | x0 | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of glo-1 in daf-2 (e1370) background. left flanking sequence: GATAAAATTTCCTACAAAGTGTTGGTAATTGGTGA; right flanking sequence: TCCAGGTGTCGGTAAAACATCTATTATTCGTCG. Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTGTTGGTAATTGGTGATCC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000898 | daf-2 | Y55D5A.5 | Caenorhabditis elegans |
WBGene00011083 | glo-1 | R07B1.12 | Caenorhabditis elegans |