1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00013974 | npr-9 | ZK455.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055262 | CGC Received | 2022-06-15 |
| Genotype | npr-9(sy1417) X. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | PS8586 |
| Outcrossed | x0 | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00013974 | npr-9 | ZK455.3 | Caenorhabditis elegans |
