WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055119 CGC Received  2022-05-25
Genotype  pah-1(syb3601) II. Laboratory  CGC
Name  PHX3601 Outcrossed  x0
Remark  Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. Species  C elegans

1 Alleles

Public Name
syb3601

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000240 pah-1 K08F8.4 Caenorhabditis elegans