WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055118 CGC Received  2022-05-25
Genotype  tph-1(mg280) pah-1(syb3596) II. Laboratory  CGC
Name  PHX3596 Outcrossed  x0
Remark  Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

2 Alleles

Public Name
mg280
syb3596

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000240 pah-1 K08F8.4 Caenorhabditis elegans
WBGene00006600 tph-1 ZK1290.2 Caenorhabditis elegans