2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000240 | pah-1 | K08F8.4 | Caenorhabditis elegans |
WBGene00006600 | tph-1 | ZK1290.2 | Caenorhabditis elegans |
WormBase ID | WBStrain00055118 | CGC Received | 2022-05-25 |
Genotype | tph-1(mg280) pah-1(syb3596) II. | Laboratory | CGC |
Name | PHX3596 | Outcrossed | x0 |
Remark | Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000240 | pah-1 | K08F8.4 | Caenorhabditis elegans |
WBGene00006600 | tph-1 | ZK1290.2 | Caenorhabditis elegans |