WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055192 CGC Received  2023-02-14
Genotype  src-1(ccp1[src-1::gfp]) I; unc-119(ed3) III; ltIs37 IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  PLG1
Outcrossed  x0 Remark  ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted at 3' end of endogenous src-1 locus using CRISPR/Cas9 engineering. gRNA sequence: AGCACAATTTTTTAGGCACT
Species  Caenorhabditis elegans

1 Alleles

Public Name
ed3

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005077 src-1 Y92H12A.1 Caenorhabditis elegans
WBGene00006843 unc-119 M142.1 Caenorhabditis elegans