WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055022 CGC Received  2022-08-25
Genotype  unc-86(ot1158)III. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  OH17241
Outcrossed  x2 Remark  unc-86(ot1158) is a CRISPR-engineered null allele removing the entire unc-86 coding region. Very slightly Unc. The repair ssODN is TCTGTCTCCTCCCAGCTTCAAGGTCCCCCTCTTTTACCTTGATTCTTTGATTAGTTTCGTTTTCGTGAAC, and the two sgRNAs are acaacatacaatgggctacc (start) caaggtccccctcttttcca (end). References: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https:
Species  C elegans

1 Alleles

Public Name
 

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006818 unc-86 C30A5.7 Caenorhabditis elegans