1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00005719 | srv-8 | F53F1.7 | Caenorhabditis elegans |
WormBase ID | WBStrain00055315 | CGC Received | 2022-06-15 |
Genotype | srv-8(sy1771) V. | Laboratory | CGC |
Mutagen | CRISPR_Cas9 | Name | PS9458 |
Outcrossed | x0 | Remark | Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srv-8. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGTTTATTTTGTAGAAATACAAATTTTATTCACT right flanking sequence: TCGAGGAATTCTACTTTCAAAGgtcagagaagata inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAATTTTATTCACTTCG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00005719 | srv-8 | F53F1.7 | Caenorhabditis elegans |