WormMine: Gene WBGene00077934

• WormBase Gene ID: WBGene00077934
• Gene Name: CRE01816
• Sequence Name: CRE01816
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domain: Nephrocystin-1. Is an ortholog of C. elegans nphp-1. In C. elegans, nphp-1 is involved in several processes, including determination of adult lifespan; male mating behavior; and non-motile cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01816.1	CRE01816.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01816	CRE01816		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111687
• Remark: CRE01816, AAGTGTCGTCCTGTTAATATTCTTGATTATTCTTTGGATCTTTTAGGTTCACATTCTATT, WBGene00077934
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term