WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035282 Gene Name  Cbr-tns-1
Sequence Name  ? CBG14907 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans tns-1. In C. elegans, tns-1 is involved in positive regulation of axon regeneration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14907e.1 CBG14907e.1   [unknown]
Transcript:CBG14907d.1 CBG14907d.1   [unknown]
Transcript:CBG14907c.1 CBG14907c.1   [unknown]
Transcript:CBG14907a.1 CBG14907a.1   [unknown]
Transcript:CBG14907b.1 CBG14907b.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14907b CBG14907b   [unknown]
CDS:CBG14907a CBG14907a   [unknown]
CDS:CBG14907d CBG14907d   [unknown]
CDS:CBG14907c CBG14907c   [unknown]
CDS:CBG14907e CBG14907e   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-tag-163, GCTGCTATCTACAGAGCTGAAACTCCCCACCGAGACATTTATGCGAGTGGAACAATAAAC, WBGene00035282   Expr1064222 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-tag-83, ACCGATCAATGTGTTTCTCAAAATTTACGAGCGACTTGTGCCTGTATACCAGTCAAAGAC, WBGene00035281   Expr1058129 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term