WormMine: Gene WBGene00182234

• WormBase Gene ID: WBGene00182234
• Gene Name: Cjp-taco-1
• Sequence Name: CJA26662
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Transcriptional regulator; Transcriptional regulator TACO1-like, domain 3; YebC-like; Integrase-like, N-terminal; and Transcriptional regulator TACO1-like. Is an ortholog of C. elegans taco-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA26662b.1	CJA26662b.1		[unknown]
Transcript:CJA26662a.1	CJA26662a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA26662a	CJA26662a		[unknown]
CDS:CJA26662b	CJA26662b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072063
• Remark: CJA26662, AAATTAGGAGGATTCCGGCTTGCTGCAGATGGTGGTGTTCGTAGTTGGTTTGAAGAAAAA, WBGene00182234
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term