WormMine: Gene WBGene00026324

• WormBase Gene ID: WBGene00026324
• Gene Name: Cbr-tbc-3
• Sequence Name: CBG03461
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Rab-GTPase-TBC domain and Rab-GTPase-TBC domain superfamily. Is an ortholog of C. elegans tbc-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03461b.1	CBG03461b.1		[unknown]
Transcript:CBG03461c.1	CBG03461c.1		[unknown]
Transcript:CBG03461a.1	CBG03461a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03461a	CBG03461a		[unknown]
CDS:CBG03461b	CBG03461b		[unknown]
CDS:CBG03461c	CBG03461c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063909
• Remark: CBG03461, GATACTCCTTCAAAATTTGCCAACCCAGTCATGGGGTGATAGAGAAATCTGCGAGCTCAC, WBGene00026324
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term