WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00184638 Gene Name  CJA29064
Sequence Name  ? CJA29064 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Sulfatase; Sulfatase, N-terminal; and Alkaline-phosphatase-like, core domain superfamily. Is an ortholog of C. elegans sul-3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA29064.1 CJA29064.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA29064 CJA29064   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA13201, CCTCCAAACCCTTTTTTATGTTTCTATCCTATCAAGCAGTACATCCACCTCTACAAGTAT, WBGene00132405   Expr1074646 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-sul-3, TTCCTCCACAAAAATGTTCGAAAGCCGTTGAGCCTTGCCGGAAGTCCTGAAAAGCTGAAC, WBGene00184638   Expr1078266 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA26685, GGGAGGGCGGAACAAAAACGACTACTTTTGTGCATTCACCAATGCATATTTCGGAAGGTG, WBGene00182257   Expr1078604 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term