WormMine: Gene WBGene00033440

• WormBase Gene ID: WBGene00033440
• Gene Name: Cbr-mfap-1
• Sequence Name: CBG12497
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Microfibrillar-associated protein 1; Microfibril-associated/Pre-mRNA processing; and Micro-fibrillar-associated protein 1, C-terminal. Is an ortholog of C. elegans mfap-1. In C. elegans, mfap-1 is involved in regulation of alternative mRNA splicing, via spliceosome.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12497.1	CBG12497.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12497	CBG12497		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068300
• Remark: Cbr-mfap-1, AAGGTGTCTGGGCATCCTCTAATCAACTGAATTCCCAATTTTACTCGAAAAGAGCTGGAG, WBGene00033440
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term