WormMine: Gene WBGene00039615

• WormBase Gene ID: WBGene00039615
• Gene Name: Cbr-hda-10
• Sequence Name: CBG20677
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Histone deacetylase domain; Ureohydrolase domain superfamily; and Histone deacetylase domain superfamily. Is an ortholog of C. elegans hda-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20677b.1	CBG20677b.1		[unknown]
Transcript:CBG20677a.1	CBG20677a.1		[unknown]
Transcript:CBG20677d.1	CBG20677d.1		[unknown]
Transcript:CBG20677d.2	CBG20677d.2		[unknown]
Transcript:CBG20677c.1	CBG20677c.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20677d	CBG20677d		[unknown]
CDS:CBG20677a	CBG20677a		[unknown]
CDS:CBG20677b	CBG20677b		[unknown]
CDS:CBG20677c	CBG20677c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057362
• Remark: Cbr-hda-6, AAACGGACTACAAAGGAGAACGAACTGTACATGCACCATATGATACTCGAGGGATCTACA, WBGene00039615
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term