WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00062622 CGC Received  2024-12-17
Genotype  algn-12(bet74) V/nT1[qls51] (IV;V). Laboratory  CGC
Mutagen  Crispr/Cas9 Name  JCB456
Outcrossed  x2 Remark  Homozygous sterile. Balanced by nT1[qIs51]. Deletion of 3471 bp in parental strain N2. Left flanking sequence: tgatcactcacagttccctgg; Right flanking sequence: gaatggatatgatgatgtatat. sgRNA #1: atgttcgtggaacgacacca; sgRNA #2: aggataaactctctcttgaa.
Species  Caenorhabditis elegans

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00022629 algn-12 ZC513.5 Caenorhabditis elegans