WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00062895 CGC Received  2025-01-29
Genotype  tph-1(ot1545) II. Laboratory  CGC
Made By  WBPerson29499 Mutagen  Crispr/Cas9
Name  OH19337 Outcrossed  x0
Remark  ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: Species  Caenorhabditis elegans

1 Alleles

Public Name
 

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006600 tph-1 ZK1290.2 Caenorhabditis elegans