WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00062835 CGC Received  2025-01-29
Genotype  ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. Laboratory  CGC
Made By  WBPerson29499 Mutagen  Crispr/Cas9
Name  OH18320 Outcrossed  x0
Remark  ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: Species  Caenorhabditis elegans

1 Alleles

Public Name
 

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000912 daf-16 R13H8.1 Caenorhabditis elegans
WBGene00002101 ins-18 T28B8.2 Caenorhabditis elegans