WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00062859 CGC Received  2025-02-11
Genotype  ins-7(ot1427) IV. Laboratory  CGC
Made By  WBPerson29499 Mutagen  Crispr/Cas9
Name  OH18835 Outcrossed  x0
Remark  ot1427 is CRISPR-engineered 1,007 bp deletion removing the entire ins-7 coding region. Sequence after edit: CTTCGAAGGATAACCCCGAAGAAGCTGTTCCAAAACATAATGGTGGCTCTTCTGGATTTTGGGTTCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
 

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002090 ins-7 ZK1251.2 Caenorhabditis elegans