2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004044 | plk-3 | F55G1.8 | Caenorhabditis elegans |
| WBGene00004178 | prg-1 | D2030.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00062227 | CGC Received | 2025-02-14 |
| Genotype | prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. | Laboratory | CGC |
| Mutagen | Crispr/Cas9 | Name | AUM1880 |
| Outcrossed | x0 | Remark | viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https: |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004044 | plk-3 | F55G1.8 | Caenorhabditis elegans |
| WBGene00004178 | prg-1 | D2030.6 | Caenorhabditis elegans |
