| WormBase ID | WBStrain00063041 | CGC Received | 2024-08-12 |
| Genotype | arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. | Laboratory | CGC |
| Mutagen | Crispr/Cas9 | Name | RG3441 |
| Remark | qIs26 [lag-2::GFP + rol-6(su1006)] III. Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Species | Caenorhabditis elegans |
