| WormBase ID | WBStrain00063072 | CGC Received | 2024-10-28 |
| Genotype | col-123(ve980[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Laboratory | CGC |
| Mutagen | Crispr/Cas9 | Name | RG3480 |
| Remark | Homozygous viable. Deletion of 1079 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. The indel of col-123 resides within an intron of catp-6. It is not known if ve980 affects catp-6 expression or function. Left flanking Sequence: ggaaatgatgggaatattttcagagttcct ; Right flanking sequence: AGGTGGAGGCGGCGGAGGCGGAGAATACAA. col-123 sgRNA A: ATGACACTTGCATtctatac; col-123 sgRNA B: TCTCATGGTGGTTCATCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000697 | col-123 | W08D2.6 | Caenorhabditis elegans |
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
