| WormBase ID | WBStrain00063308 | CGC Received | 2024-07-24 |
| Genotype | +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/tpk-1(hd7129 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III | Laboratory | CGC |
| Mutagen | Crispr/Cas9 | Name | VH7133 |
| Outcrossed | x0 | Remark | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001072 | dpy-10 | T14B4.7 | Caenorhabditis elegans |
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
| WBGene00014027 | tpk-1 | ZK637.9 | Caenorhabditis elegans |
