| WormBase ID | WBStrain00063328 | CGC Received | 2024-12-09 |
| Genotype | mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-2 7p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV. | Laboratory | CGC |
| Mutagen | Crispr/Cas9 | Name | VH7165 |
| Outcrossed | x0 | Remark | Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004471 | rps-2 | C49H3.11 | Caenorhabditis elegans |
| WBGene00006745 | unc-5 | B0273.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
| WBGene00021920 | mrps-25 | Y55F3AM.1 | Caenorhabditis elegans |
