WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024889 Gene Name  Cbr-wapl-1
Sequence Name  ? CBG01692 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Wings apart-like protein regulation of heterochromatin; Armadillo-type fold; Wings apart-like protein, C-terminal; Wings apart-like protein; and Armadillo-like helical. Is an ortholog of C. elegans wapl-1. In C. elegans, wapl-1 is involved in positive regulation of double-strand break repair via homologous recombination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01692.1 CBG01692.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01692 CBG01692   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01692, GAAGGAAGTGTGATTGCTTCCTATCATGCCTTGCTCACTGGCTTCGTTTTGCAACAAAAT, WBGene00024889   Expr1055019 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term