WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00082275 Gene Name  CRE22753
Sequence Name  ? CRE22753 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: DHS-like NAD/FAD-binding domain superfamily; Electron transfer flavoprotein domain; Electron transfer flavoprotein, alpha/beta-subunit, N-terminal; Electron transfer flavoprotein FAD-binding domain; Electron transfer flavoprotein, alpha subunit, C-terminal; and Rossmann-like alpha/beta/alpha sandwich fold. Is an ortholog of C. elegans F27D4.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE22753.1 CRE22753.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE22753 CRE22753   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE22753, AGCTGACTACTGGTTAGTTGGTGATTTGAATACTGTTGTTCCAGAATTAGTTTCTAAACT, WBGene00082275   Expr1106160 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term