WormMine: Gene WBGene00023586

• WormBase Gene ID: WBGene00023586
• Gene Name: Cbr-ivns-1
• Sequence Name: CBG00102
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Kelch-type beta propeller; Galactose oxidase/kelch, beta-propeller; Kelch motif; Kelch repeat type 1; BTB/POZ domain; BTB/Kelch-associated; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans ivns-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00102.1	CBG00102.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00102	CBG00102		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067810
• Remark: Cbr-tag-147, AGGCTTATGATCCAAAGACAAACACATGGCGTCAACTTCCGAAGCTCCGGCAGGCAAGAC, WBGene00023586
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term