WormMine: Gene WBGene00037550

• WormBase Gene ID: WBGene00037550
• Gene Name: Cbr-ins-17
• Sequence Name: CBG18055
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Insulin-like superfamily. Is an ortholog of C. elegans ins-17. In C. elegans, ins-17 is involved in dauer larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18055.1	CBG18055.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18055	CBG18055		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050274
• Remark: Cbr-ins-17, AACAATGAATCACTGCTGTGAGAATGGCTGCGAATTCACCGACATCTTCGCGATCTGCAA, WBGene00037550
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term