WormMine: Gene WBGene00029964

• WormBase Gene ID: WBGene00029964
• Gene Name: CBG08101
• Sequence Name: CBG08101
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: F-box-like domain superfamily and F-box domain. Is an ortholog of C. elegans F56F10.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08101c.1	CBG08101c.1		[unknown]
Transcript:CBG08101d.1	CBG08101d.1		[unknown]
Transcript:CBG08101a.1	CBG08101a.1		[unknown]
Transcript:CBG08101b.1	CBG08101b.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08101a	CBG08101a		[unknown]
CDS:CBG08101c	CBG08101c		[unknown]
CDS:CBG08101b	CBG08101b		[unknown]
CDS:CBG08101d	CBG08101d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050785
• Remark: CBG08101, AAAGCTGGGAGCAAAACTCAAGGAGCGATTTAACCATCATGTTGAGCCACTGTTACCCGG, WBGene00029964
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term