WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035111 Gene Name  Cbr-dlg-1
Sequence Name  ? CBG14691 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; L27 domain superfamily; PDZ superfamily; L27 domain; PDZ domain; Guanylate kinase/L-type calcium channel beta subunit; SH3-like domain superfamily; L27-1; Guanylate kinase; SH3 domain; and L27_1. Is an ortholog of C. elegans dlg-1. In C. elegans, dlg-1 is involved in embryo development and zonula adherens assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG14691.1 CBG14691.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG14691 CBG14691   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dlg-1, CAGATGCCAGCGAATCGAGCAAAGTTTCGGAGACTTGTTCACTCGTAAGTTGCAAGCTAG, WBGene00035111   Expr1066751 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term